Saturday, 4 June 2022

Can the Irrationality in Mathematics be Explained by Genetic Codes Expressed in the Square Root of the Number Ten?| Chapter 3 | Novel Research Aspects in Mathematical and Computer Science Vol. 4

 The square root of ten, an irrational quantity, is investigated in this article to see whether there is a link between it and DNA patterns. After the comma, the square root digits of the number ten are subjected to a one-by-one addition process. Second, the nucleotide bases are represented by the result of the addition. Finally, the nucleotide bases (A, T, C, and G) [(A) Adenine, (T) Thymine, (C) Cytosine, and (G) Guanine] are used to express the findings. The resultant gene sequencing is [ATAAGTCATAAGTGTATTAGTTTAAAACTG] when the first four hundred digits of the square root of the number ten following the comma are computed [1]. Fourth, certain similar repeats were recognised at the same time, such as "AGT" and "ATA." Fifth, when this sequence was searched in NCBI (National Biotechnology Information Center), the results showed that it was related to bony fish, particularly Danio Aesculapii [2]. Finally, the Zebrafish is closely linked to the Danio Aesculapii [3]. In conclusion, not only the square root of ten in mathematics, but many more irrational numbers (as explained by the similar QUANTUM PERSPECTIVE MODEL in previous articles; see Table-2) are used to provide a common perspective on these various sciences; the link between genetic codes in biochemistry and irrational numbers in mathematics has proven to be significant and has revealed very valuable results. To put it another way, this groundbreaking study has opened a new door to fresh transdisciplinary discoveries.


Author(s) Details:

Tahir Olmez,
Department of Social Sciences, Selçuk University, Selcuklu, Konya, Turkey.

Please see the link here: https://stm.bookpi.org/NRAMCS-V4/article/view/7031

No comments:

Post a Comment