Evaluation of the Resistance of Five Tomato Varieties to Bacterial Wilt (Ralstonia solanacearum) under the Agro-climatic Conditions of Katibougou | Chapter 8 | Microbiology and Biotechnology Research: An Overview Vol. 4

 

The objective of this research is to contribute to the improvement of tomato productivity in Mali. Tomatoes remain one of the most widely grown vegetable crops in the world. It is the most consumed vegetable in the world after potatoes. However, its production faces enormous difficulties such as the extreme poverty of the soil, the low technicality of the producers, the high pest pressure and the scarcity of high-performance varieties. Of these, bacterial wilt is an important factor, as it causes a huge loss of production on average if left unchecked. A study was carried out on the evaluation of the resistance of five varieties of tomato (Anaya, Raja, Tingal, Mona and Petomek) to bacterial wilt (Ralstonia solanacearum) in the agro-climatic conditions of Katibougou. The experimental device used was the Fisher block with three (03) repetitions to five (05) treatments. The analysis of biometric observations shows that the Raja variety had the largest diameter at the collar with 12.13 cm at the 60th day after transplanting, the highest number of leaves at 40.1, it also gave the highest number of branches with 9.8 and also the greatest height of the plants with 82.5 cm. Regarding the incidence of bacterial wilt, the Petomek variety (T5) had the highest percentage with 73%, followed by the Anaya variety (T1) which had 70%. As for the severity, a total of three (03) observations were made, the analysis of variance showed a significant difference between the levels of variation, the Petomek variety (T5) had the highest score with 85.9%, followed by the Anaya variety (T1) which recorded 84.4% and finally the Tingal (T3) and Mona (T4) varieties had the lowest scores 24.4%. In terms of yield, the Tingal variety had the best yield with 45.83 t/ha, followed by the Mona variety with 39.46 t/ha. Finally, the Anaya and Petomek treatments gave the lowest yields with 21.66 t/ha and 20.55 t/ha, respectively.

 

Author(s) Details

Fodé KEITA
Rural Polytechnic Institute for Training and Applied Research (IPR/IFRA) of Katibougou, Department of Studies and Research (DER) of Agricultural Sciences and Techniques (STA), Plant Protection Unit, BP 06, Koulikoro, Mali.

Michel KARPUKHIN
Department of Agricultural Sciences, Vice-Rector for Research and Innovation at the Ural State Agrarian University, Yekaterinburg, Russia.

 

Bakary SAGARA
Rural Polytechnic Institute for Training and Applied Research (IPR/IFRA) of Katibougou, Department of Studies and Research (DER) of Agricultural Sciences and Techniques (STA), Plant Protection Unit, BP 06, Koulikoro, Mali.

 

Mahamoudou TRAORE
Rural Polytechnic Institute for Training and Applied Research (IPR/IFRA) of Katibougou, Department of Studies and Research (DER) of Agricultural Sciences and Techniques (STA), Plant Protection Unit, BP 06, Koulikoro, Mali.

 

Please see the book here:- https://doi.org/10.9734/bpi/mbrao/v4/5404

Antifungal Effect of Plant Leaf Extracts on Postharvest Decay and Shelf Life of Tomato Fruits in Storage | Chapter 8 | Current Research Progress in Agricultural Sciences Vol. 7

 The present study was conducted to determine the Antifungal effect of plant leaf extracts on shelf life and postharvest decay of tomato fruits during storage in Makurdi. Preservation and storage of tomato fruits are important to the economy of individual homes and farmers considering the vital role tomatoes play in the health of people and food security. Tomato fruits of the Roma variety were dipped in conidia suspensions of the test fungi after which they were dipped in the aqueous extracts of each plant extract and stored at room temperature. The results revealed an increase in marketability, and postharvest decay in fruits respectively from 1.00 to 8.40, 0.00 to 5.67 while weight decreased from 44.3 to 20.27 across all treatments. Treated tomato fruits showed significantly lower postharvest decay (0.00 – 1.02) compared to the control. The present study revealed the presence of phytochemicals such as alkaloids, flavonoids, carbohydrates, glycosides, saponins, tannins and terpenoids in the aqueous leaf extracts of Moringa, Neem and bitter leaf. Phytochemicals are non–nutritive plant chemicals which occur naturally in plants that have protective or disease-preventive properties. Phytochemical analysis of leaf extracts of Moringa, Neem and bitter leaf screened for the presence of carbohydrates, glycosides and cardiac glycosides, saponins, steroids, triterpenes, tannins and flavonoids indicated present (+) respectively for each plant leaf extract while alkaloids indicated present (+) for bitter leaf extract and anthraquinones were absent (-) in each extract. Plant powders and their extracts can extend the shelf life and preserve the physicochemical quality of tomato fruits while they are being stored. They also have antifungal potential. This is a crucial stage in creating plant-based biopesticides, which will be the best remedy for upcoming plant disease control initiatives.

 

Author (s) Details

 

Liamngee, K.
Department of Biological Sciences, Benue State University, Makurdi, Nigeria.

 

Zakki, Y. H.
Department of Biological Sciences, Benue State University, Makurdi, Nigeria.

 

Manguts, Y.
Food Strategic Reserve Department, Makurdi, Nigeria.

 

Ochida, C.O.
Center for Food Technology and Research, Benue State University, Makurdi, Nigeria.

Iyaji A.A.
Center for Food Technology and Research, Benue State University, Makurdi, Nigeria.

 

Please see the book here:- https://doi.org/10.9734/bpi/crpas/v7/3735

Nematicidal Action of Chitosan Nanoformulation: A Detailed Study | Chapter 6 | Chemistry and Biochemistry: Research Progress Vol. 2

Biopolymers are naturally occurring materials formed during the life cycle of plants, animals, bacteria, and fungi. Chitosan is the second most abundant biopolymer available in the world, second only to cellulose. It is found in crustaceous shells, e.g., those of crabs, shrimps, prawns, and fungi, as well as insect exoskeletons. The use of nano-formulations for the management of pests and diseases is receiving increased interest with the advancement of nanotechnology. Here, chitosan nanospheres were obtained from chitosan using the ionic gelation technique. The nano-formulations obtained were characterized using a particle size analyzer, Fourier transform infrared spectroscopy, and a transmission electron microscope. The efficacy of chitosan nanospheres in suppressing the root-knot nematode Meloidogyne incognita was studied. The particle size of nanospheres formulated for this study was 380.2 nm, with a polydispersity index (PI) of 0.4 and zeta potential of 45.7 or 50.9 mV at pH 5.2. The chitosan nanospheres were spherical, and the particles did not agglomerate. FTIR spectra of the chitosan nanospheres peaked at 3334 cm-1, thereby indicating the stretching of the OH and NH groups. In in-vitro studies, chitosan nanospheres showed significant nematicidal activity against M. incognita. Under pot culture conditions, chitosan nanospheres (1% active compound chitosan) at 2 ml/plant decreased the nematode population in roots or soil. Compared to the control, the number of galls was reduced by 83.68%, the number of egg masses by 83.85%, the number of adult females by 66.56%, and the number of second-stage juveniles by 73.20%. In a field experiment, the application of chitosan nanospheres (1%) was followed by an 18.75% increase in fruit yield compared to the non-treated control. The study concluded that as chitosan nanospheres are synthesized from a biological source, the formulation is environmentally friendly and does not leave any toxic residues in the ecosystem.

 

Author (s) Details

R. Mouniga
Tamil Nadu Agricultural University, Coimbatore (Tamil Nadu), India.

B. Anita
Tamil Nadu Agricultural University, Coimbatore (Tamil Nadu), India.

A. Lakshmanan
Tamil Nadu Agricultural University, Coimbatore (Tamil Nadu), India.

A. Shanthi
Tamil Nadu Agricultural University, Coimbatore (Tamil Nadu), India.

G. Karthikeyan
Tamil Nadu Agricultural University, Coimbatore (Tamil Nadu), India.

 

Please see the book here:- https://doi.org/10.9734/bpi/cbrp/v2/3958

Earthing up and Pruning Systems on Post-Harvest Quality of Tomato (Solanum lycopersicon) | Chapter 11 | Emerging Issues in Agricultural Sciences Vol. 1

 This study researched the effects of earthing up and trimming systems on the post-harvest quality of attractive woman. For both the field and workshop studies, the tests were conducted in split-plots set up in randomized complete block design (RCBD) and reserved random field (CRD), individually. Data on fruit yield was collected following each harvest. The average burden loss % and total dissolved solids in two together cultivations were significantly affected apiece factors (earthing up and trimming system) as determined by the judgments of the analysis of difference for those factors' individual and combined belongings. The average weight deficit %, total soluble solid residue from liquid solution, and fruit firmness in two together cultivations were significantly jolted by the treatments. The arrangements with all stem shearing and no earthing up demonstrated the highest product weight misfortune percentages. The highest crop firmness (3.41 N mm-1 in cultivation 1 and 3.24 N mm-1 in sophistication 2) was recorded from a sole stem pruning system and earthing until 30 cm. 6.09 % was recorded.The cultivations accompanying the highest total dissolved solids (TSS) percentages used a distinct stem pruning design and up to 30 cm of earthing. Farmers are urged to consider using a threefold stem pruning system as well 30 cm of earthing to optimize attractive woman postharvest.

Author(s) Details:

I. K. Keter,
Department of Plant Sciences, Chuka University, P.O. Box 109-60400, Chuka, Kenya and Kenya Agricultural and Livestock Research Organization (KALRO), Coffee Research Institute, Koru Sub Center, P.O. Box 15-40104, Koru, Kenya.

G. O. Oloo-Abucheli,
Department of Plant Sciences, Chuka University, P.O. Box 109-60400, Chuka, Kenya.

M. Muraya,
Department of Plant Sciences, Chuka University, P.O. Box 109-60400, Chuka, Kenya.

C. T. Kiplangat,
Department of Plant Sciences, Chuka University, P.O. Box 109-60400, Chuka, Kenya.

Please see the link here: https://stm.bookpi.org/EIAS-V1/article/view/9821

Parasitic Contamination of Lettuce, Tomato and Cucumber from Vegetable Farms in Mali| Chapter 6 | Current Topics in Agricultural Sciences Vol. 7

The goal of this study was to identify parasite contaminants in lettuce, tomato, and cucumber from some Mali vegetable producing areas in order to estimate the health risk associated with their use. Fresh veggies are an important part of a healthy diet. They have the potential to spread intestinal parasites if consumed raw. On thirty-two lettuce, tomato, and cucumber samples from irrigated vegetable fields in Bamako, Kati, Baguineda, Samanko, Sikasso, and Niono, the frequency and diversity of parasite eggs were studied. The parasite burden was determined by counting parasite eggs and cysts in 100 g of vegetable. Overall, 20.83 percent of vegetables were parasite-infested, with lettuce accounting for 41.66 percent and tomato accounting for 16.66 percent. There were no parasite eggs on the cucumber. Entamoeba coli and Trichomonas intestinalis (both 24.19 percent) were found on the vegetables, as well as Ascaris lumbricoides (13.25 percent), Giardia intestinalis (12.9 percent), Balantidium coli (11.29 percent), Entamoeba histolitica (7.26 percent), Fasciola hepatica (3.23 percent), Trichinella spiralis (1.61 percent), Ancylostoma duoden (1.04 percent each). Parasites on lettuce were discovered in 83.33 percent of cases in Bamako and Niono, 50.00 percent in Kati, 16.66 percent in Baguineda and Samanko, and 0.00 percent in Sikasso. Customers are putting their health at danger by eating parasite-infested veggies. Some agronomic procedures used by Mali's vegetable producers might be a source of parasite contamination, putting farmers' and customers' health at risk. Undecomposed manure, open defecation on farms, drain run-off, polluted soil and irrigation water, and overhead irrigation are all possible causes of contamination in lettuce, tomato, and cucumber farms. Scientific quantitative data was required to track the process by which parasites reach irrigated crops and to identify crucial spots where health risk reduction strategies might be implemented.

Author(s) Details:

Sanata Traore,
Faculty of Sciences and Techniques; University of Sciences, Techniques and Technologies of Bamako, Mali, P. O. Box E 3206, Bamako, Mali.

Fasse Samake,
Faculty of Sciences and Techniques; University of Sciences, Techniques and Technologies of Bamako, Mali, P. O. Box E 3206, Bamako, Mali and Institute of Applied Sciences; University of Sciences, Techniques and Technologies of Bamako, Mali, P. O. Box E 3206, Bamako, Mali.

Mamadou Weleba Bagayoko,
Faculty of Sciences and Techniques; University of Sciences, Techniques and Technologies of Bamako, Mali, P. O. Box E 3206, Bamako, Mali.

Amadou Hamadoun Babana,
Faculty of Sciences and Techniques; University of Sciences, Techniques and Technologies of Bamako, Mali, P. O. Box E 3206, Bamako, Mali.

Please see the link here: https://stm.bookpi.org/CTAS-V7/article/view/6782 

Determining the Effect of Front Line Demonstrations on Trellis Method of Cultivation in Tomato (Solanum lycopercicum Mill.) in Khammam District of Telangana, India | Chapter 04 | Current Topics in Agricultural Sciences Vol. 5

 The current research was carried out in the Krishi Vigyan Kendra, Wyra adopted villages in Telangana's Khammam District. Tomatoes are a major vegetable crop in the district, although yields are low due to poor quality, early deterioration, pests, and disease outbreaks. KVK, Wyra made an effort to address the problem of lowering pests and disease incidence while also improving fruit quality by introducing the Trellis method of tomato cultivation. On-farm trials with a small number of farmers were used to test this on a modest scale for three years. As the main thrust areas of KVKs are refining and demonstration of novel technologies, training of farmers and extension functionaries, this technology was up-scaled and disseminated on a large scale with the support of front line demonstrations. From 2016-17 to 2018-19, Krishi Vigyan Kendra, Wyra, Khammam held front-line demonstrations on tomato trellising in its adopted villages with the goal of improving tomato yield and quality by incorporating trellising, drip and mulching, indeterminate hybrid varieties, balanced fertiliser use, and integrated pest and disease management. Despite the fact that trellising has been around for a long time, the district's tomato producers had little awareness of it and were slow to adopt it. The study's data, such as cultivation costs, production, productivity, gross returns, and net returns, were collected and analysed on time. The study's findings revealed that the average greatest yield recorded in the demonstration plot was 622.58 q/ha, compared to 431.55 q/ha in the control plot, a yield increase of 191.03 q/ha, and a 44.33 percent average yield increase over the control plot. The study found that the extension and technology gaps varied from 183.45 to 201.80 q/ha and 11.40 to 41.25 q/ha, respectively, with a technology index of 4.21 percent during the demonstration years. In addition, when compared to farmer's practise, the displayed plots had a greater gross return, net return, and benefit cost ratio. The impact of FLD on horizontal spread, which has grown by 160.36 percent, was also investigated in this study. Due to high knowledge and adoption of the full package of practises, such as use of trellis method of training tomato plants, application of farm yard manure, recommended dose of fertilisers, fertigation, mulching, and so on, higher average yields were obtained in demonstration plots over the years compared to farmer's practise. The research also included a formative and summative (outcome and impact) evaluation of the frontline trellising demonstrations in Tomato.

Author(S) Details 

V. Chaitanya
Krishi Vigyan Kendra, Wyra, Khammam, Professor Jayashankar Agriculture University, Telangana, 507165, India.

J. Hemantha Kumar
Krishi Vigyan Kendra, Wyra, Khammam, Professor Jayashankar Agriculture University, Telangana, 507165, India.

B. R. Madhushekar
Krishi Vigyan Kendra, Wyra, Khammam, Professor Jayashankar Agriculture University, Telangana, 507165, India.

P. Jagan Mohan Rao
Regional Agriculture Research Station, Warangal, 506006, India.

P. Sri Ranjitha
Krishi Vigyan Kendra, Wyra, Khammam, Professor Jayashankar Agriculture University, Telangana, 507165, India.

K. Ravi Kumar
Krishi Vigyan Kendra, Wyra, Khammam, Professor Jayashankar Agriculture University, Telangana, 507165, India.

Y. G. Prasad
ICAR- ATARI, Zone-X, Hyderabd, 500059, India.

View Book:- https://stm.bookpi.org/CTAS-V5/article/view/5257

Study on the Effects of Mineral Fertilizers on Growth, Fruit Yield and Nutrient Uptake of Tomato (Lycopersicon lycopersicum Mill) in Ogbomoso and Mokwa, Nigeria | Chapter 06 | Recent Progress in Plant and Soil Research Vol. 3

 In the 2013 cropping season, field experiments were conducted at the Teaching and Research Farm, Ladoke Akintola University of Technology, Ogbomoso, and the Niger State College of Agriculture, Mokwa, to investigate the effects of mineral fertilisers on tomato growth, fruit yield, and nutrient uptake. In the country, tomato agriculture has progressed from a traditional intercropping system with other staple crops to a much more economically driven strategy. The treatments included three mineral fertiliser types at three rates each, as well as their combinations: N (0, 30, and 60 kg N ha-1), P (0, 25, and 50 kg P2O5ha-1), and K (0, 25, and 50 kg K2O5ha-1) (0, 16.5 and 33 kg K2O ha-1). The treatments were laid out in a three-times repeated Randomized Complete Block Design (RCBD). Plant height, number of leaves per plant, number of flowers per plant, number of fruits per plant, total fruit output, and nutrient intake were all taken into account. Leaf phytochemical contents were determined at random per plot and examined for nutrient uptake, such as N, P, K, Ca, and Mg levels. The data was analysed with the SAS package's analysis of variance (ANOVA), and the treatment means were separated with the Duncan Multiple Range Test (DMRT) at a 5% probability level. The study's goal was to find mineral fertiliser combinations that would boost nutrient uptake and help tomatoes perform better. Tomato yield and nitrogen uptake enhanced when mineral fertiliser was applied externally. The highest fruit output (27.81 t ha-1) came from the application of 60 kg N ha-1 + 50 kg P2O5 ha-1 + 33 kg K2O ha-1, whereas the lowest came from the control plot (9.96 t ha-1). The optimal fertiliser rates for nutrient uptake (P, K) were 60 kg N ha-1 + 50 kg P2O5 ha-1 + 33 kg K2O ha-1. To summarise, external mineral fertiliser input is required to increase tomato yield and nutrient absorption content. Plants fertilised with 60 kg N ha-1 + 50 kg P2O5 ha-1 + 33 kg K2O ha-1 responded better than those treated with other rates, and farmers can use this combination to boost productivity in the study locations.

Author(S) Details

M. N. Tswanya
Biotechnology Advanced Research Centre, Sheda Science and Technology Complex, P.M.B. 186, Garki-Abuja, Nigeria.

J. O. Olaniyi
Department of Agronomy, Faculty of Agricultural Sciences, Ladoke Akintola University of Technology, P.M.B. 4000, Ogbomoso, Oyo State, Nigeria.

M. Ahmed
IFAD Value Chain Development Programme, Opposite Abdulsalam Garage, Tunga, Minna, Niger State, Nigeria.

View Book:- https://stm.bookpi.org/RPPSR-V3/article/view/4481

Design and Performance Evaluation of an Indirect Solar Dryer: A Recent Study| Chapter 10 | Cutting-edge Research in Agricultural Sciences Vol. 13

Based on meteorological data of mean monthly values of ambient temperature, wind speed, and global solar radiation, which were 22.2oC, 3.64 m/s, and 206 W/m2 respectively, an indirect solar dryer was designed, fabricated, and evaluated in an attempt to reduce post-harvest losses of tomato that gluts in Mubi, Adamawa State, Nigeria, from August to October each year. The projected dryer has a solar collector inclined at an angle of 20.26oC to the horizontal, with an air mass-flow rate of 3.106 X 10-3 kg/s and an overall mean drying rate of 0.140 kg/h. It also had a 0.115 m3/s air volumetric flow rate and 0.065m thick lagging material. During the study months, the dryer determined that drying tomatoes from a postharvest moisture content of 95.6 percent (d.b) to a storage moisture content of 15.8 percent (d.b) took 50.8 hours (d.b). More research is needed to determine the effects of incorporating an additional source of heat or a heat reservoir to ensure day and night drying, which will improve the drying rate and, as a result, reduce drying time, following the development and evaluation of tomato-fruit dryers in other parts of the world. Tomato colour, firmness, flavour, nutritional value, and safety are all affected by the composition of the fruit at harvest and changes in composition during postharvest processing.

Author (S) Details

Bashir Aliyu
Department of Agricultural & Environmental Engineering, Modibbo Adama University of Technology, Yola, Adamawa, Nigeria.

E. K. Bwade
Department of Agricultural & Bio-Environmental Engineering Technology, Federal Polytechnic, Mubi, Adamawa, Nigeria.

View Book :- https://stm.bookpi.org/CRAS-V13/article/view/3821

Tomato (Lycopersicon esculentum) Extracts Elicit Anti-Hepatotoxic Effects on Acetaminophen-Induced Liver Injury in Albino Wistar Rat | Chapter 4 | Technological Innovation in Pharmaceutical Research Vol. 10

 Introduction: Drug overdose is the largest cause of liver injury in the world today, according to numerous reports. Natural antioxidant-rich diets have been shown to provide significant relief from drug-induced organ damage.

The goal of this investigation was to see if tomato extract could protect rats from acetaminophen-induced acute hepatotoxicity.

Methods: Phytochemical tests were carried out. A total of 24 albino rats weighing 11010 g were divided into four groups (A-D), each with six rats. The usual control group, Group A, received no treatment. The negative control group got only a single dose of acetaminophen (750 mg/kg, i.p) as a single dose. The test group got a single dose of acetaminophen (750 mg/kg, i.p.) before receiving 14 days of therapy with tomato extract (30 mg/kg, oral). For 14 days, Group D was given tomato extract (30 mg/kg, oral) and acetaminophen (750 mg/kg, i.p) at the same time.

When compared to normal (p0.05 or p0.01), a single dosage of Acetaminophen induced liver cell damage and a significant increase in the levels of the liver enzymes: AST (67.6711.41U/L); ALT (46.3310.59U/L); and ALP (223.7023.31U/L) in rats in negative control. On the liver enzyme marker levels, daily injection of tomato extract was able to reduce the acetaminophen-induced hepatotoxicity: AST (23.00 3.61U/L, P0.01), ALT (17.67 3.48U/L, P0.05), and ALP (121.308.11U/L, P0.01) were all higher in Group C. When compared to the negative control group, AST (26.672.91U/L, P0.01), ALT (18.671.76 U/L, P0.05), and ALP (124.729.33U/L, P0.01) were significantly higher in Group D. In comparison to the normal control group, histological data demonstrated no substantial liver injury in the tomato extract groups.

Tomato extract has hepatoprotective properties against acetaminophen-induced liver damage.

Author (S) Details

I. K. Uchendu
Department of Medical Laboratory Science, Division of Clinical Chemistry, University of Nigeria, Enugu Campus, Enugu State, Nigeria.

C. E. Agu
Department of Medical Laboratory Science, Division of Clinical Chemistry, University of Calabar, Nigeria.

O. C. Orji
Department of Medical Laboratory Science, Division of Clinical Chemistry, University of Nigeria, Enugu Campus, Enugu State, Nigeria.

E. B. Nnedu
Department of Medical Laboratory Science, Division of Immunology, University of Nigeria, Enugu Campus, Nigeria.

C. Arinze
Department of Medical Laboratory Science, Division of Clinical Chemistry, University of Nigeria, Enugu Campus, Enugu State, Nigeria.

A. C. Uchenna
Department of Medical Laboratory Science, Division of Medical Microbiology, University of Nigeria, Enugu Campus, Enugu State, Nigeria.

U. C. Okongwu
Department of Medical Laboratory Science, Division of Medical Microbiology, University of Nigeria, Enugu Campus, Enugu State, Nigeria.

View Book :- https://stm.bookpi.org/TIPR-V10/article/view/2841

Determination of Post-Harvest Microbial Deterioration of Tomato (Lycopersiconesculentum) Fruits| Chapter 5| Recent Progress in Plant and Soil Research Vol. 2

 This study looked into the microbiological, chemical, and environmental factors that contribute to the rotting of this vital vegetable. From rotting tomato fruits, a total of eight microorganisms (fungi and bacteria) were recovered. These isolates were utilised to conduct pathogenicity tests on healthy fruits, both wounded and unwounded, and it was discovered that fungi cause more degradation than bacteria. Temperature and milton were tested to see how they affected the rotting of the meat.fruits. The rate of deterioration appears to grow as the temperature rises. The use of milton was found to be useful in reducing rotting. The amount of ascorbic acid in fresh and decaying fruits was also tested. Ascorbic acid levels decreased as degradation progressed, according to the findings.

Author (s) Details

Matthew, Titus
Department of Biology, College of Education, Minna, Niger State, Nigeria.

View Book :-https://stm.bookpi.org/RPPSR-V2/article/view/2666

Plant Bio-chemicals against Helicoverpa armigera (Hübner): A Study in Tomato |Chapter 11 | Cutting-edge Research in Agricultural Sciences Vol. 10

 The mechanism of host plant resistance in tomato varieties was evaluated and compared to the attack of the tomato fruit borer, Helicoverpa armigera (Hubner), in the Solan district, known as the “Tomato Bowl of Himachal Pradesh.” Understanding the mechanisms of induced resistance allows us to predict which pests will be affected by induced responses. Induced response elicitors can be sprayed on crop plants to strengthen the natural defense system against herbivore damage. Three self pollinating indeterminate varieties developed by selection (Solan Lalima, Solan Vajar, and Palam Pink) and four hybrids (Naveen 2000+, Heem Sohna, and Palam Pink) were used in the experiment. Researchers extracted various macro and micronutrients from the foliage of these varieties, as well as estimating the chemical composition of tomato fruits, such as total phenols, titrable acidity, reducing sugars, and total sugars, to compare for different levels of resistance to Helicoverpa armigera. Fruit infestation was found to be inversely related to phenol and sugar content in tomato fruits, as measured by correlation coefficient values (r= -0.895) and (r= -0.650), respectively, indicating that less susceptible varieties were high in phenols and sugars, protecting them from pest attack. Nitrogen (r= 0.660), potassium (r=0.679), magnesium (r=0.698), and iron (r= 0.547) are all related. Phosphorus (r= -0.857) and zinc (r= -0.801) content were found to be positively correlated with percent fruit infestation, whereas manganese (r=0.546) content was found to be negatively correlated with percent fruit infestation. This resistance can be used to create crop cultivars that rapidly produce the inducible response in the face of a mild infestation, and it can be used as an important component of integrated pest management alongside other techniques such as biological, cultural, and chemical control.

Author (s) Details

Priyanka Thakur
Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry, Nauni – 173230, HP, India.

R. S. Rana
Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry, Nauni – 173230, HP, India.

K. C. Sharma
Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry, Nauni – 173230, HP, India.

Nalini Challa
Department of Entomology, Dr Y S Parmar University of Horticulture and Forestry, Nauni – 173230, HP, India.

View Book :- https://stm.bookpi.org/CRAS-V10/article/view/1568

Critical Evaluation of Types and Classification of Pesticides Used on Tomatoes Grown in Mwea Irrigation Scheme, Kirinyaga County, Kenya | Chapter 11 | Current Research in Agricultural and Food Science Vol. 4

In the Mwea Irrigation System, this study assessed 403 farmers from open fields and greenhouses on the types and classifications of pesticides used by farmers to combat pests and diseases in tomatoes from July 2017 to June 2018. Without the use of pesticides in industrialized and developing countries, it is virtually impossible to produce enough food to satisfy market demand for quality and quantity. Five greenhouse tomato farmers were chosen deliberately, while the sample size was determined using Fisher's formula for 196 open field farmers. To collect data from 201 farmers in the Gathingiri, Tebere, Kangai, Wamumu, Murinduko, Nyangati, Mutithi and Thiba wards, a cross-sectional design using a formal questionnaire and focus group discussions was used. Pre-testing of the questionnaire on tomato farmers from the neighbouring sub-county of Maragua ensured the accuracy of the results. Errors were corrected and the questionnaire added omissions. In order to determine significant differences between variables, descriptive statistics were carried out for frequencies, ratios, means, standard errors, variance and data subjected to T-test at 95 percent confidence intervals. Results from interviews showed that farmers applied 57 and 12 pesticides to tomatoes in open fields and greenhouses, respectively, under different trade names. Among others, pyrethroids, carbamates, nicotinoids, organophosphates, and organochlorines have been added to tomatoes. WHO class II (60 percent) and WHO class III (42 percent), respectively, were the 20 and 12 pesticides primarily used in open fields and greenhouses. In order to manage a wide range of major pests and diseases such as Tuta absoluta and blight, farmers have relied heavily on various types of pesticides. The main pesticides used on tomatoes are chlorantraniliprole and mancozeb. In order to avoid human health hazards, most WHO toxic class II pesticides, including pyrethroids and carbamates, should be used according to the guidelines of the manufacturers. Compliance with the requirements for the use of pesticides would prevent residues from occurring in tomatoes and other vegetables and thereby minimize their effect on human health. Training and knowledge of the use of less toxic pesticides equally effective in controlling pests and diseases, such as WHO classes III and IV, and bio-pesticides with minimal adverse effects on human health, are needed by the Ministry of Agriculture, Kirinyanga County Government.

Author (s) Details

Mrs. Momanyi, Violet Nakhungu
Department of Environmental and Occupational Health, Kenyatta University, P.O.Box 43844-00100, Nairobi, Kenya and Kenya Agricultural and Livestock Research Organization, Food Crops Research Centre, KALRO Kabete, P.O.Box 14733-00800, Nairobi, Kenya.

Prof. N. Keraka, Margaret
School of Public Health, Kenyatta University, P.O.Box 43844-00100, Nairobi, Kenya.

Dr. A. Abong’o, Deborah
Department of Chemistry, School of Physical Sciences, College of Biological and Physical Sciences, University of Nairobi, P.O.Box 30197-00100, Nairobi, Kenya.

Dr. N. Warutere, Peterson
Department of Environmental and Occupational Health, Kenyatta University, P.O.Box 43844-00100, Nairobi, Kenya.

View Book :- https://stm.bookpi.org/CRAFS-V4/issue/view/30

Molecular Detection of Groundnut Bud Necrosis Isolates in Tomato (Lycopersicon esculentum Mill.) in Andhra Pradesh | Chapter 4 | Cutting-edge Research in Agricultural Sciences Vol.1

 The Groundnut bud necrosis virus in tomato (GBNV-To) was maintained on cowpea cv. C-152 in the

laboratory. Cowpea was selected as an assay host for the maintenance of the virus, since it has
consistently produced more local lesions within four to five days after inoculation. The virus isolates
were further confirmed by DAC (Direct antigen coating)-ELISA. Twelve samples have shown positive
reaction under DAC-ELISA and the OD values were recorded at 405 nm from the infected and healthy
plants. Out of the these 12 isolates, six isolates representing one each from Kurnool, Kadapa,
Chittoor, Guntur, Nizamabad and Godavari were selected for molecular detection. Total RNA was
isolated from the six virus isolates by triazol method using plant RNA easy isolation kit (Qiagen). The
purity and integrity of the isolated RNA was checked on denatured agarose gel electrophoresis in TBE
(Tris-Borate-EDTA) buffer system. The RNA of six isolates from Kurnool, Kadapa, Chittoor, Guntur,
Godavari and Nizamabad districts were subjected to reverse transcription–polymerase chain reaction
(RT–PCR) amplification using CP gene primers. The genome sense primer, 50-ATGTCTAACGT(C/T)
AAGCA (A/G) CTC-30 and antisense primer, 50- TTACAATTCCAGCGAAGGACC 30 were used to
amplify the complete CP gene (size*800bp) of GBNV [1]. Amplified products were resolved by
electrophoresis through a 1% agarose gel containing ethidium bromide. Agarose gel electrophoresis
of DNA was performed as described by Sambrook et al., (1989). Among six isolates, the nucleocapsid
protein (N) gene of isolates, such as tomato isolate Kurnool, tomato-isolate Chittoor, tomato-isolate
Guntur, tomato-isolate Godavari and tomato-isolate Nizamabad were amplified. The primers were
selectively amplified approximately 830 bp products in RT–PCR. The 830-bp cDNA band of the above
three positive GBNV-To isolates were gel eluted, purified and ligated into TA cloning (pTZ57R/T)
vector (Fermantas) and transformed into competent Escherichia coli cells (DH5a) and plated on
ampicillin. X-gal and IPTG (Isopropyl-b thiogaloctopyranoside) containing LB (Luria-Bertani) medium
was incubated at 37°C for overnight. The recombinant amino acid levels with available sequences of
GBNV in Gen Bank using BIO-EDIT and MEGA software. The sequence has been deposited in NCBI
Gen bank (Acc.No.HM 195249). The N gene was compared with that of the other known
Tospoviruses recorded in India. Cluster dendrogram revealed that the tomato Tospovirus from
Kurnool district was most closely related to GBNV forming one cluster. Comparative sequence
analyses showed that the tomato Tospovirus shared maximum sequence identity with GBNV at
nucleotide (93–99%) as well as amino acid (93%) levels. The nucleotide and amino acid sequence
identities were observed with N genes of other Tospoviruses. A close sequence relationship between
the N genes of the tomato Tospovirus and GBNV was in agreement with the serological data. In the
present studies it is determined that the GBNV-To isolate of tomato prevalent in A.P is regarded as
the same strain of GBNV already existing in India.

Author(s) Details

Mrs. Dr. C. Ruth
Department of Plant Pathology, Dr. YSR Horticultural University, College of Horticulture, Anantharajupeta, Kadapa Dt.,
Andhra Pradesh, India.

View Book :- http://bp.bookpi.org/index.php/bpi/catalog/book/229