The Groundnut bud necrosis virus in tomato (GBNV-To) was maintained on cowpea cv. C-152 in the
laboratory. Cowpea was selected as an assay host for the maintenance of the virus, since it hasconsistently produced more local lesions within four to five days after inoculation. The virus isolates
were further confirmed by DAC (Direct antigen coating)-ELISA. Twelve samples have shown positive
reaction under DAC-ELISA and the OD values were recorded at 405 nm from the infected and healthy
plants. Out of the these 12 isolates, six isolates representing one each from Kurnool, Kadapa,
Chittoor, Guntur, Nizamabad and Godavari were selected for molecular detection. Total RNA was
isolated from the six virus isolates by triazol method using plant RNA easy isolation kit (Qiagen). The
purity and integrity of the isolated RNA was checked on denatured agarose gel electrophoresis in TBE
(Tris-Borate-EDTA) buffer system. The RNA of six isolates from Kurnool, Kadapa, Chittoor, Guntur,
Godavari and Nizamabad districts were subjected to reverse transcription–polymerase chain reaction
(RT–PCR) amplification using CP gene primers. The genome sense primer, 50-ATGTCTAACGT(C/T)
AAGCA (A/G) CTC-30 and antisense primer, 50- TTACAATTCCAGCGAAGGACC 30 were used to
amplify the complete CP gene (size*800bp) of GBNV [1]. Amplified products were resolved by
electrophoresis through a 1% agarose gel containing ethidium bromide. Agarose gel electrophoresis
of DNA was performed as described by Sambrook et al., (1989). Among six isolates, the nucleocapsid
protein (N) gene of isolates, such as tomato isolate Kurnool, tomato-isolate Chittoor, tomato-isolate
Guntur, tomato-isolate Godavari and tomato-isolate Nizamabad were amplified. The primers were
selectively amplified approximately 830 bp products in RT–PCR. The 830-bp cDNA band of the above
three positive GBNV-To isolates were gel eluted, purified and ligated into TA cloning (pTZ57R/T)
vector (Fermantas) and transformed into competent Escherichia coli cells (DH5a) and plated on
ampicillin. X-gal and IPTG (Isopropyl-b thiogaloctopyranoside) containing LB (Luria-Bertani) medium
was incubated at 37°C for overnight. The recombinant amino acid levels with available sequences of
GBNV in Gen Bank using BIO-EDIT and MEGA software. The sequence has been deposited in NCBI
Gen bank (Acc.No.HM 195249). The N gene was compared with that of the other known
Tospoviruses recorded in India. Cluster dendrogram revealed that the tomato Tospovirus from
Kurnool district was most closely related to GBNV forming one cluster. Comparative sequence
analyses showed that the tomato Tospovirus shared maximum sequence identity with GBNV at
nucleotide (93–99%) as well as amino acid (93%) levels. The nucleotide and amino acid sequence
identities were observed with N genes of other Tospoviruses. A close sequence relationship between
the N genes of the tomato Tospovirus and GBNV was in agreement with the serological data. In the
present studies it is determined that the GBNV-To isolate of tomato prevalent in A.P is regarded as
the same strain of GBNV already existing in India.
Author(s) Details
Mrs. Dr. C. Ruth
Department of Plant Pathology, Dr. YSR Horticultural University, College of Horticulture, Anantharajupeta, Kadapa Dt.,
Andhra Pradesh, India.
View Book :- http://bp.bookpi.org/index.php/bpi/catalog/book/229